resolvase उदाहरण वाक्य
उदाहरण वाक्य
- The entire resolvase recombination reaction can be reproduced " in vitro ", requiring only resolvase, a substrate DNA and multivalent cations, using either wild type protein or hyperactive mutants.
- Although the sequences of the inverted terminal repeats of the rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends, which may constitute a signal for the Holliday junction resolvase and DNA replication.
- The MUS81-MMS4 endonuclease, although a minor resolvase for CO formation in " S . cerevisiae ", is crucial for limiting chromosome entanglements by suppressing multiple consecutive recombination events from initiating from the same DSB.
- The now classical members gamma-delta and Tn3 resolvase, but also new additions like ?C31-, Bxb1-, and R4 integrases, cut all four DNA strands simultaneously at points that are staggered by 2bp ( Fig . 2 ).
- During cleavage, a protein-DNA bond is formed via a transesterification reaction in which a phosphodiester bond is replaced by a phosphoserine bond between a 5 phosphate at the cleavage site and the hydroxyl group of the conserved serine residue ( S10 in resolvase ).